paper n a pcl eco addgene (Addgene inc)

Addgene inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Addgene inc paper n a pcl eco addgene
Paper N A Pcl Eco Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 465 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pcl+eco+addgene/pCL-Eco+(Plasmid+%2312371)/pm41923640-301-102-105
Average 96 stars, based on 465 article reviews

paper n a pcl eco addgene - by Bioz Stars, 2026-10

96/100 stars

Images

Control:

Article Title: Sulfur partitioning from cysteine controls T cell proliferation and effector function.
Article Snippet: Cas9 nuclease V3 Integrated DNA Technologies Cat# 189471812 Alt-R CRISPR-Cas9 tracrRNA, 100 nmol Integrated DNA Technologies Cat# 1072534 Alt-R Cas9 Electroporation enhancer Integrated DNA Technologies Cat#1075916 P4 primary cell 4D-nucleofectorTM X kit S Lonza Cat# V4XP-4032 Poly-D-lysine hydrobromide Millipore Sigma Cat# P6407 Cell lysis buffer (10X) Cell Signaling Technology Cat# 9803S Tributylamine Millipore Sigma Cat# 90780 Medronic acid MedChemExpress Cat# HY-108309 Ammonium carbonate Millipore Sigma Cat# 379999 Acetonitrile LC/MS grade Fisher Chemical Cat# A955-212 Water, Optima LC/MS grade Fisher Chemical Cat# W64 2-propanol Fisher Chemical Cat# A461-4 Methanol, Optima LC/MS grade Fisher Chemical Cat# A456-4 Ferrous ammonium sulfate, hexahydrate Millipore Sigma Cat# FX0245-1 2,2′-bipyridyl Millipore Sigma Cat# D216305 TEMPO MedChemExpress Cat# HY-W001187 Phenylmethyl sulfonyl fluoride (PMSF) solution Millipore Sigma Cat# 93482 LDS sample buffer (4X) Novex Cat# B0007 DTT Millipore Sigma Cat# 1019777701 NuPAGE 4 – 12% Bis-Tris midi gel, 20 well Thermo Fisher Scientific Cat# WG1402BOX Blotting-Grade blocker, nonfat dry milk Biorad Cat# 1706404 SuperSignal West Pico PLUS chemiluminescent substrate Thermo Fisher Scientific Cat# 34578 SuperSignal West Femto maximum sensitivity substrate Thermo Fisher Scientific Cat# 34095 Brefeldin A solution (1000X) Biolegend Cat# 420601 Lipofectamine 3000 transfection reagent Thermo Fisher Scientific Cat# L3000015 Cytofix/Cytoperm fixation and permeabilization solution BD Bioscience Cat# 554722 eBioscience Foxp3/Transcription factor staining buffer set eBioscience Cat# 00-5523-00 Retro-X Concentrator Takara Bio USA Cat# 631455 TaqMan Fast Advanced Master Mix Applied Biosystems Cat# 4444557 CHAC1 overexpression lysate Novus Biologicals Cat# NBP2-06348 (Continued on next page) ll OPEN ACCESS e3 Cell 189, 1–17.e1–e11, June 11, 2026 Please cite this article in press as: Kelly et al., Sulfur partitioning from cysteine controls T cell proliferation and effector function, Cell (2026), https://doi.org/10.1016/j.cell.2026.03.012 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Control/non-targeting gRNA: GCGAGGTATTCGGCTCCGCG Integrated DNA Technologies N/A NFS1 KO gRNA: ACCTCTCACATGGACGTAC Integrated DNA Technologies N/A GCLC KO gRNA: TACATGATCGAAGGAACGCC Integrated DNA Technologies N/A ISD11 KO gRNA: CACAAGTTTTAGATCTGTAC Integrated DNA Technologies N/A CTH KO gRNA: AAGATGGGTAATCGTAATGG Integrated DNA Technologies N/A GLRX1 gRNA: TAAATAATCTTGAATCGCAC Integrated DNA Technologies N/A GLRX2 gRNA: GAGTTGGATATGCTGGAATA Integrated DNA Technologies N/A GLRX3 gRNA: TTCATTAGTACTAGGAGGAA Integrated DNA Technologies N/A GLRX5 gRNA: CTACAACGTGCTGGACGACC Integrated DNA Technologies N/A ABCE1.1.AA gRNA: TATTAGAGATCGAATCGTAA Integrated DNA Technologies N/A ABCE1.1.AB gRNA: CCCAAAACTTCACCTGGACG Integrated DNA Technologies N/A ABCE1.1.AK gRNA: ACTTCACCTGGACGAGGGAT Integrated DNA Technologies N/A Recombinant DNA MSCV-Bbsl-2A-Thy1.1 This paper N/A MSCV-NFS1-2A-Thy1.1 This paper N/A pCL-Eco addgene Cat# 12371; RRID: Addgene_12371 Software and algorithms FlowJo 10 TreeStar RRID: SCR_008520 GraphPad Prism 10 GraphPad RRID: SCR_002798 Metaboscape versions 2022 – 2024b Bruker RRID: SCR_026044 TASQ versions 2022 – 2024b Bruker N/A Compass Hystar Bruker N/A ImageJ Schneider et al.91 RRID: SCR_003070 featureCounts v. 2.18.0, v. 2.0.3 Liao et al.92 RRID: SCR_012919 Seurat Stuart et al.,93 Hafemeister et al.94 RRID: SCR_007322 R Project for Statistical Computing v. 4.3.1 R Core Team95 RRID: SCR_001905 SCTransform Hafemeister et al.94 RRID: SCR_022146 SignatuR Andreatta et al.96 N/A Harmony v. 1.2.0 Korsunsky et al.97 RRID: SCR_022206 Uniform manifold approximation and projection (UMAP) McInnes et al.98 RRID: SCR_018217 Clustree v. 0.5.1 Zappia et al.99 RRID:SCR_016293 cluster v. 2.1.6 Maechler et al.100 RRID: SCR_013505 scGate v. 1.6.2 Andreatta et al.101 N/A deepTools v 2.0 Ramı́rez et al.102 RRID: SCR_016366 STAR v 2.7.10 Kaminow et al.103 RRID: SCR_004463 DESeq2 v 1.36 Love et al.104 RRID: SCR_015687 Morpheus Broad Institute RRID:SCR_014975 DAVID Jiao et al.105 N/A nmrPipe Delaglio et al.106 N/A Sparky Lee et al.107 RRID: SCR_014228 TopSpin v 4.3.0 Bruker RRID: SCR_014227 BD FACSDiva software BD Biosciences RRID: SCR_001456 Cytek Spectroflo software Cytek RRID: SCR_025494 (Continued on next page) ll OPEN ACCESS e5 Cell 189, 1–17.e1–e11, June 11, 2026 Please cite this article in press as: Kelly et al., Sulfur partitioning from cysteine controls T cell proliferation and effector function, Cell (2026), https://doi.org/10.1016/j.cell.2026.03.012 Article .. C57BL/6J (RRID: IMSR_JAX:000664), major histocompatibility complex (MHC) class I-restricted OVA-specific TCR OT-I transgenic mice (C57BL/6-Tg(TcraTcrb)1100Mjb/J; RRID: IMSR_JAX:003831), CD45.1+ C57BL/6J (B6.SJL-Ptprca Pepcb/BoyJ;Jax, 002014), and CD90.1+ C57BL/6J (B6.PL-Thy1a/CyJ; RRID: JAX: IMSR_JAX:000406) mouse strains were purchased from the Jackson Laboratory.

Recombinant:

Article Title: Alteration of Tumor Metabolism by CD4+ T Cells Leads to TNF-α-Dependent Intensification of Oxidative Stress and Tumor Cell Death
Article Snippet: .. ΔCyba This paper N/A 293FT ATCC PTA-5077 Experimental Models: Organisms/Strains HA-TCR Tg Mice ( Kirberg et al., 1994 ) N/A BALB/c Mice Charles River Laboratories 555 Oligonucleotides Please see Table S1 for qRT-PCR primer sequences This paper N/A Please see Table S2 for sgRNA synthsis oligos and screening primer sequences for CRISPR/Cas9 This paper N/A Recombinant DNA 1D3scFv.CD28.CD3 ( Kochenderfer et al., 2010 ) N/A Mig.luciferase.rCD2 This paper N/A pCL-Eco Addgene Cat#: 12371 Software and Algorithms Prism 4.0 GraphPad Software N/A FlowJo software Treestar N/A PIMSoft Perimed N/A GeneArt CRISPR gRNA Design Tool Thermo Fisher N/A Other RPMI 1640 medium HyClone SH30027.02 DMEM medium HyClone SH30243.01 Opti-MEM Medium Gibco 31985-062 Fetal Bovine Serum HyClone SH30396.03 Open in a separate window KEY RESOURCES TABLE CONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for resources and reagents should be directed to the Lead Contact, Gang Zhou ( ude.atsugua@uohzg ). .. EXPERIMENTAL MODEL AND SUBJECT DETAILS Cell Culture Conditions Murine colorectal cancer cell line CT26 (ATCC), mammary carcinoma 4T1 (ATCC) and B-cell lymphoma cell line A20 (ATCC) were cultured in RPMI 1640 (HyClone Laboratories) supplemented with 10% fetal bovine serum albumin (FBS), 1% penicillin/streptomycin (HyClone Laboratories), 1% non-essential amino acids and 1% glutamine (Corning) at 37°C in a 5% CO2 incubator.

Article Title: Alteration of Tumor Metabolism by CD4+ T Cells Leads to TNF-α-Dependent Intensification of Oxidative Stress and Tumor Cell Death
Article Snippet: .. ΔCyba This paper N/A 293FT ATCC PTA-5077 Experimental Models: Organisms/Strains HA-TCR Tg Mice ( Kirberg et al., 1994 ) N/A BALB/c Mice Charles River Laboratories 555 Oligonucleotides Please see Table S1 for qRT-PCR primer sequences This paper N/A Please see Table S2 for sgRNA synthsis oligos and screening primer sequences for CRISPR/Cas9 This paper N/A Recombinant DNA 1D3scFv.CD28.CD3 ( Kochenderfer et al., 2010 ) N/A Mig.luciferase.rCD2 This paper N/A pCL-Eco Addgene Cat#: 12371 Software and Algorithms Prism 4.0 GraphPad Software N/A FlowJo software Treestar N/A PIMSoft Perimed N/A GeneArt CRISPR gRNA Design Tool Thermo Fisher N/A Other RPMI 1640 medium HyClone SH30027.02 DMEM medium HyClone SH30243.01 Opti-MEM Medium Gibco 31985-062 Fetal Bovine Serum HyClone SH30396.03 Open in a separate window KEY RESOURCES TABLE .. A total of 601 compounds were analyzed and ANOVA contrasts were used to identify metabolites that differ significantly between various experimental groups. . Generation of CT26HA.ΔTNFR1 and CT26HA.ΔCyba Cell Lines by CRSIPR/Cas 9 DNA oligonucleotides used for gRNAs were designed using the GeneArt CRISPR gRNA Design Tool.

Article Title: Metabolic Imaging Reveals a Unique Preference of Symmetric Cell Division and Homing of Leukemia-Initiating Cells in an Endosteal Niche.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse c-Kit-APC eBioscience Cat# 17-1171-82; RRID: AB_469430 Anti-mouse Sca-1-PECy7 eBioscience Cat# 25-5981-82; RRID: AB_469669 Anti-mouse CD16/32-eFluor 450 eBioscience Cat# 48-0161-82; RRID: AB_1272191 Anti-mouse CD34-PE eBioscience Cat# 12-0349-42; RRID: AB_1548680 Anti-mouse Mac-1-APC eBioscience Cat# 17-0112-83; RRID: AB_469344 Anti-mouse Gr-1-PE eBioscience Cat# 12-5931-83; RRID: AB_466046 Streptavidin PerCP-Cyanine5.5 eBioscience Cat# 45-4317-82; RRID: AB_10311495 Anti-human/mouse CD45R(B220)-PE eBioscience Cat# 12-0452-85; RRID: AB_465673 Anti-mouse CD144-Alexa Fluor 488 eBioscience Cat# 53-1441-82; RRID: AB_1210527 Anti-mouse CD144-eFluor 660 eBioscience Cat# 50-1441-82; RRID: AB_11219483 Anti-mouse Gr-1- Biotin eBioscience Cat# 13-5931-85; RRID: AB_466801 Anti-mouse CD127-Biotin eBioscience Cat# 13-1271-82; RRID: AB_466588 Anti-mouse TER-119-Biotin eBioscience Cat# 13-5921-85; RRID: AB_466798 Anti-mouse CXCR4-Biotin eBioscience Cat# 13-9991-82; RRID: AB_10609202 Anti-mouse CD45R(B220)-Biotin Thermo Fisher Scientific Cat# 13-0452-85; RRID: AB_466450 Anti-mouse CD3e Biotin eBioscience Cat# 13-0031-85; RRID: AB_466320 Anti-mouse CD3e-APC BD Bioscience Cat# 17-0031-82; RRID: AB_469315 Anti-c-Kit R&D Systems Cat# AF1356; RRID: AB_354750 Anti-Laminin Abcam Cat# ab11575; RRID: AB_298179 Anti-Ki-67 CST Cat# 9129; RRID: AB_2687446 Anti-HIF1A Abcam Cat# ab179483; RRID: AB_2732807 Anti-b-actin Calbiochem Cat# CP01; RRID: AB_566293 Anti-Goat IgG (H+L) Alexa Fluor 647 Thermo Fisher Scientific Cat# A-21447; RRID: AB_2535864 Anti-Rabbit IgG (H+L) Alexa Fluor 555 Thermo Fisher Scientific Cat# A-31572; RRID: AB_162543 Bacterial and Virus Strains DH5a Competent Cells Thermo Fisher Scientific Cat# 18258012 Biological Samples See Table S3 This paper N/A Chemicals, Peptides, and Recombinant Proteins 2-NBDG Invitrogen N13195 TMRE Invitrogen 87917 Rapamycin Selleck Chemicals S1039 Nocodazole CST 2190 HypoxiSense 680 Fluorescent Imaging Agent PerkinElmer NEV11070 Vybrant DiD Cell-Labeling Solution Invitrogen V22887 Dextran-FITC Sigma-Aldrich FD70S Poly-D-lysine hydrobromide Sigma-Aldrich P7886 Critical Commercial Assays Lactate Assay Kit Sigma-Aldrich MAK064-1KT;2M07K06070 XF Cell Mito Stress Test Kit Agilent 103015-100 XF Glycolysis Stress Test Kit Agilent 103020-100 XF Cell Energy Phenotype Test Kit Agilent 103325-100 XF Base Medium Agilent 102353-100 XFe96 FluxPak mini Agilent 102601-100 (Continued on next page) Cell Metabolism 29, 1–16.e1–e6, March 5, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Cell Lines THP-1 ATCC Cat# TIB-202; RRID: CVCL_0006 C1498 ATCC Cat# TIB-49; RRID: CVCL_3494 MA9 Gift from Dr. Mulloy, J.C. Wei et al., 2008 HEK-293T ATCC Cat# CRL-3216; RRID: CVCL_0063 Experimental Models: Organisms/Strains C57BL/6 mouse Slac Laboratory SCXK(2013-0018) NOD-SCID mouse Slac Laboratory SCXK(2013-0018) Col2.3-GFP transgenic mouse Jackson Laboratory 013134 Oligonucleotides qPCR-primers See Table S2 N/A PDK2 Luciferase primers See Table S2 N/A Recombinant DNA pMD2G This paper N/A pSPAX2 This paper N/A pCL-ECO Addgene #12371 shRNA See Table S2 N/A Software and Algorithms GraphPad Prism 7 GraphPad Software RRID: SCR_002798 NIS-Elements Viewer 4.50 NiKon https://www.nikon.com/products/microscope-solutions/ support/download/software/imgsfw/nis_v45000win.htm Image J Fiji http://fiji.sc/ SPSS IBM https://www.ibm.com/analytics/spss-statistics-software FlowJo v10 FlowJo RRID: SCR_008520 L-Calc Software STEMCELL Technologies #28600 Photoshop Adobe https://www.adobe.com/uk/products/photoshop.html Other StemSpan SFEM STEMCELL Technologies Cat# 09605 ..

Software:

Article Title: Alteration of Tumor Metabolism by CD4+ T Cells Leads to TNF-α-Dependent Intensification of Oxidative Stress and Tumor Cell Death
Article Snippet: .. ΔCyba This paper N/A 293FT ATCC PTA-5077 Experimental Models: Organisms/Strains HA-TCR Tg Mice ( Kirberg et al., 1994 ) N/A BALB/c Mice Charles River Laboratories 555 Oligonucleotides Please see Table S1 for qRT-PCR primer sequences This paper N/A Please see Table S2 for sgRNA synthsis oligos and screening primer sequences for CRISPR/Cas9 This paper N/A Recombinant DNA 1D3scFv.CD28.CD3 ( Kochenderfer et al., 2010 ) N/A Mig.luciferase.rCD2 This paper N/A pCL-Eco Addgene Cat#: 12371 Software and Algorithms Prism 4.0 GraphPad Software N/A FlowJo software Treestar N/A PIMSoft Perimed N/A GeneArt CRISPR gRNA Design Tool Thermo Fisher N/A Other RPMI 1640 medium HyClone SH30027.02 DMEM medium HyClone SH30243.01 Opti-MEM Medium Gibco 31985-062 Fetal Bovine Serum HyClone SH30396.03 Open in a separate window KEY RESOURCES TABLE .. A total of 601 compounds were analyzed and ANOVA contrasts were used to identify metabolites that differ significantly between various experimental groups. . Generation of CT26HA.ΔTNFR1 and CT26HA.ΔCyba Cell Lines by CRSIPR/Cas 9 DNA oligonucleotides used for gRNAs were designed using the GeneArt CRISPR gRNA Design Tool.

Mouse Assay:

Article Title: Alteration of Tumor Metabolism by CD4+ T Cells Leads to TNF-α-Dependent Intensification of Oxidative Stress and Tumor Cell Death
Article Snippet: .. ΔCyba This paper N/A 293FT ATCC PTA-5077 Experimental Models: Organisms/Strains HA-TCR Tg Mice ( Kirberg et al., 1994 ) N/A BALB/c Mice Charles River Laboratories 555 Oligonucleotides Please see Table S1 for qRT-PCR primer sequences This paper N/A Please see Table S2 for sgRNA synthsis oligos and screening primer sequences for CRISPR/Cas9 This paper N/A Recombinant DNA 1D3scFv.CD28.CD3 ( Kochenderfer et al., 2010 ) N/A Mig.luciferase.rCD2 This paper N/A pCL-Eco Addgene Cat#: 12371 Software and Algorithms Prism 4.0 GraphPad Software N/A FlowJo software Treestar N/A PIMSoft Perimed N/A GeneArt CRISPR gRNA Design Tool Thermo Fisher N/A Other RPMI 1640 medium HyClone SH30027.02 DMEM medium HyClone SH30243.01 Opti-MEM Medium Gibco 31985-062 Fetal Bovine Serum HyClone SH30396.03 Open in a separate window KEY RESOURCES TABLE .. A total of 601 compounds were analyzed and ANOVA contrasts were used to identify metabolites that differ significantly between various experimental groups. . Generation of CT26HA.ΔTNFR1 and CT26HA.ΔCyba Cell Lines by CRSIPR/Cas 9 DNA oligonucleotides used for gRNAs were designed using the GeneArt CRISPR gRNA Design Tool.

Quantitative RT-PCR:

Article Title: Alteration of Tumor Metabolism by CD4+ T Cells Leads to TNF-α-Dependent Intensification of Oxidative Stress and Tumor Cell Death
Article Snippet: .. ΔCyba This paper N/A 293FT ATCC PTA-5077 Experimental Models: Organisms/Strains HA-TCR Tg Mice ( Kirberg et al., 1994 ) N/A BALB/c Mice Charles River Laboratories 555 Oligonucleotides Please see Table S1 for qRT-PCR primer sequences This paper N/A Please see Table S2 for sgRNA synthsis oligos and screening primer sequences for CRISPR/Cas9 This paper N/A Recombinant DNA 1D3scFv.CD28.CD3 ( Kochenderfer et al., 2010 ) N/A Mig.luciferase.rCD2 This paper N/A pCL-Eco Addgene Cat#: 12371 Software and Algorithms Prism 4.0 GraphPad Software N/A FlowJo software Treestar N/A PIMSoft Perimed N/A GeneArt CRISPR gRNA Design Tool Thermo Fisher N/A Other RPMI 1640 medium HyClone SH30027.02 DMEM medium HyClone SH30243.01 Opti-MEM Medium Gibco 31985-062 Fetal Bovine Serum HyClone SH30396.03 Open in a separate window KEY RESOURCES TABLE .. A total of 601 compounds were analyzed and ANOVA contrasts were used to identify metabolites that differ significantly between various experimental groups. . Generation of CT26HA.ΔTNFR1 and CT26HA.ΔCyba Cell Lines by CRSIPR/Cas 9 DNA oligonucleotides used for gRNAs were designed using the GeneArt CRISPR gRNA Design Tool.

CRISPR:

Article Title: Alteration of Tumor Metabolism by CD4+ T Cells Leads to TNF-α-Dependent Intensification of Oxidative Stress and Tumor Cell Death
Article Snippet: .. ΔCyba This paper N/A 293FT ATCC PTA-5077 Experimental Models: Organisms/Strains HA-TCR Tg Mice ( Kirberg et al., 1994 ) N/A BALB/c Mice Charles River Laboratories 555 Oligonucleotides Please see Table S1 for qRT-PCR primer sequences This paper N/A Please see Table S2 for sgRNA synthsis oligos and screening primer sequences for CRISPR/Cas9 This paper N/A Recombinant DNA 1D3scFv.CD28.CD3 ( Kochenderfer et al., 2010 ) N/A Mig.luciferase.rCD2 This paper N/A pCL-Eco Addgene Cat#: 12371 Software and Algorithms Prism 4.0 GraphPad Software N/A FlowJo software Treestar N/A PIMSoft Perimed N/A GeneArt CRISPR gRNA Design Tool Thermo Fisher N/A Other RPMI 1640 medium HyClone SH30027.02 DMEM medium HyClone SH30243.01 Opti-MEM Medium Gibco 31985-062 Fetal Bovine Serum HyClone SH30396.03 Open in a separate window KEY RESOURCES TABLE .. A total of 601 compounds were analyzed and ANOVA contrasts were used to identify metabolites that differ significantly between various experimental groups. . Generation of CT26HA.ΔTNFR1 and CT26HA.ΔCyba Cell Lines by CRSIPR/Cas 9 DNA oligonucleotides used for gRNAs were designed using the GeneArt CRISPR gRNA Design Tool.

Review

paper n a pcl eco addgene (Addgene inc)

Structured Review

Images

Related Articles

Control:

Recombinant:

Software:

Mouse Assay:

Quantitative RT-PCR:

CRISPR:

Transgenic Assay:

Real-time Polymerase Chain Reaction:

Luciferase:

shRNA:

Similar Products

Image Search Results